Hacker News with Generative AI: Genetics

Genetics, not shared envs, drives parent-child similarities in intelligence (psypost.org)
How much of your cognitive ability is shaped by your genetic inheritance compared to the environment you grow up in? A new study published in Research in Social Stratification and Mobility suggests that the transmission of cognitive ability from parents to children is primarily driven by genetics, with little influence from shared environmental factors like family resources. The findings challenge traditional assumptions in social mobility research that often attribute these correlations primarily to socio-economic status.
Genetics, Intelligence, Family, Social Mobility, Research
42 points by amichail 2 days ago | 16 comments
Across southeastern US, weedy rice steals herbicide resistance from crop rice (phys.org)
Weedy rice is a close relative of cultivated rice that infests rice fields worldwide and drastically reduces yields.
Agriculture, Genetics, Biology, Environmental Science, Invasive Species
7 points by PaulHoule 6 days ago | 3 comments
Ancient DNA may rewrite prehistory in India (bbc.com)
New research using ancient DNA is rewriting prehistory in India - and shows that its civilisation is the result of multiple ancient migrations, writes Tony Joseph.
Ancient History, India, Genetics, Archaeology, Migration
4 points by akbarnama 12 days ago | 1 comments
Why some individuals with disease-causing mutations remain symptom-free (neurosciencenews.com)
New work by Columbia researchers has turned a textbook principle of genetics on its head and revealed why some people who carry disease-causing genes experience no symptoms.
Genetics, Health, Science, Research
9 points by superbaconman 13 days ago | 0 comments
High-resolution genomic history of early medieval Europe (nature.com)
Many known and unknown historical events have remained below detection thresholds of genetic studies because subtle ancestry changes are challenging to reconstruct.
Genetics, History, Europe, Archaeology
47 points by bookofjoe 14 days ago | 11 comments
Zebrafish protein unlocks dormant genes for heart repair (hubrecht.eu)
Researchers from the Bakkers group at the Hubrecht Institute have successfully repaired damaged mouse hearts using a protein from zebrafish.
Biotechnology, Heart Health, Regeneration, Animal Research, Genetics
135 points by manmal 14 days ago | 61 comments
Genetics of Highly Pathogenic Avian Influenza A(H5N1) Viruses ID'd in LA Person (cdc.gov)
CDC has sequenced the influenza viruses in specimens collected from the patient in Louisiana who was infected with, and became severely ill from HPAI A(H5N1) virus. The genomic sequences were compared to other HPAI A(H5N1) sequences from dairy cows, wild birds and poultry, as well as previous human cases and were identified as the D1.1 genotype.
Genetics, Avian Influenza, Public Health, Virology
4 points by rntn 20 days ago | 0 comments
Epigenetic inheritance of diet-induced and sperm-borne mitochondrial RNAs (nature.com)
Apart from Mendelian inheritance, fathers use alternative routes for intergenerational information transfer. One of these is a complex, dynamic and environment-sensitive pool of sncRNAs that are stored in mature spermatozoa1, delivered to the oocytes at fertilization9, and influence embryonic development10,11 and adult phenotypes1,2,3,4,5,6,7,11.
Genetics, Biology, Science, Epigenetics, Reproduction
3 points by gradus_ad 21 days ago | 0 comments
An infinite DNA glitch saved millions [video] (youtube.com)
DNA, Genetics, Science, Technology, Video
49 points by f1shy 22 days ago | 21 comments
A Woman with a Rare Gene Mutation Fights to Avoid Her Mother's Fate (nytimes.com)
A mutant gene is coming to steal Linde Jacobs’s mind. Can she find a way to stop it?
Genetics, Health, Science, Medical Research
9 points by gmays 23 days ago | 1 comments
Ancient genomes provide final word in Indo-European linguistic origins (phys.org)
A team of 91 researchers—including famed geneticist Eske Willerslev at the Lundbeck Foundation GeoGenetics Center, University of Copenhagen—has discovered a Bronze Age genetic divergence connected to eastern and western Mediterranean Indo-European language speakers.
Genetics, Linguistics, History, Archeology
65 points by Brajeshwar 23 days ago | 16 comments
The risk of cancer fades past the age of 80 (sciencealert.com)
Aging brings two opposing trends in cancer risk: first, the risk climbs in our 60s and 70s, as decades of genetic mutations build up in our bodies. But then, past the age of around 80, the risk drops again – and a new study may explain a key reason why.
Cancer, Aging, Genetics, Science, Health
181 points by gpi 27 days ago | 48 comments
Saving the Apple's Ancient Ancestor in the Forests of Kazakhstan (smithsonianmag.com)
Found in the Tian Shan mountains, Malus sieversii could hold the secret to making other species of the fruit more stress-resistant
Conservation, Botany, Kazakhstan, Genetics
11 points by vector_spaces 28 days ago | 2 comments
Oldest human genomes reveal how a small group burst out of Africa (nytimes.com)
DNA from European fossils dating back 45,000 years offers new clues to how our species spread across the world.
Genetics, Human Evolution, Archaeology, History
99 points by diodorus 33 days ago | 90 comments
Finding the Mango's Origin (2017) (fairchildgarden.org)
We think we know our mangos, but much of their origin is a mystery researchers are trying to unravel through exploration, DNA research and other methods. They’ve even begun to ask if all cultivars of this incredibly diverse fruit are truly the same species.
Botany, Fruit, Research, Genetics, History
27 points by Tomte 34 days ago | 4 comments
Molecular machines that loop chromosomes also twist DNA (phys.org)
Scientists from the Kavli Institute of Delft University of Technology and the IMP Vienna Biocenter have discovered a new property of the molecular motors that shape our chromosomes.
Genetics, Molecular Biology, DNA, Chromosomes, Scientific Research
53 points by wglb 35 days ago | 10 comments
Anti–USAG-1 therapy for tooth regeneration through enhanced BMP signaling (nlm.nih.gov)
Cell-free molecular therapy targeting USAG-1 is effective in the treatment of a wide range of congenital tooth agenesis.
Biotechnology, Dentistry, Stem Cells, Regeneration, Genetics
4 points by thunderbong 35 days ago | 1 comments
How big data created the modern dairy cow (worksinprogress.co)
What do cryogenics, butterfat tests, and genetic data have in common? They’re some of the reasons behind the world’s most productive dairy cows. Here’s how it all started.
Agriculture, Big Data, Genetics, Dairy
48 points by surprisetalk 36 days ago | 58 comments
A new timeline for Neanderthal interbreeding with modern humans (news.berkeley.edu)
A new analysis of DNA from ancient modern humans (Homo sapiens) in Europe and Asia has determined, more precisely than ever, the time period during which Neanderthals interbred with modern humans, starting about 50,500 years ago and lasting about 7,000 years — until Neanderthals began to disappear.
Human Evolution, Genetics, Archaeology, Neanderthals
70 points by diodorus 36 days ago | 55 comments
The 24 DNA letters linked to autism: GCAAGGACATATGGGCGAAGGAGA (elpais.com)
Around one in 100 people live with an autism spectrum disorder, a developmental brain disorder characterized by difficulties in social interaction and unusual behavior patterns, such as an acute attention to detail.
Genetics, Autism, Neuroscience, Health
4 points by marban 44 days ago | 0 comments
Dog domestication happened many times, but most didn't pan out (arstechnica.com)
Between 8,000 and 12,000 years ago, people in Alaska kept reinventing dogs with mixed results.
Dogs, Domestication, Archaeology, Genetics, History
15 points by rntn 44 days ago | 0 comments
Neuroevolution of augmenting topologies (NEAT algorithm) (wikipedia.org)
NeuroEvolution of Augmenting Topologies (NEAT) is a genetic algorithm (GA) for the generation of evolving artificial neural networks (a neuroevolution technique) developed by Kenneth Stanley and Risto Miikkulainen in 2002 while at The University of Texas at Austin.
Artificial Intelligence, Machine Learning, Evolutionary Algorithms, Neural Networks, Genetics
91 points by elsewhen 47 days ago | 33 comments
Francis Crick's "Central Dogma" was misunderstood (asimov.press)
The Central Dogma is a linchpin for understanding how cells work, and yet it is one of the most widely misunderstood concepts in molecular biology.
Biology, Science, Molecular Biology, Genetics
124 points by ctoth 47 days ago | 66 comments
Cause of rare devastating, autoimmune disease in Puerto Ricans–and possible cure (medicalxpress.com)
A rare autoimmune condition with a tongue-twister of a name may impact people of Puerto Rican heritage through a newly discovered genetic pathway, a discovery that may ultimately guide genetic counseling and treatment, scientists associated with the discovery say.
Genetics, Autoimmune Disease, Medicine
61 points by wglb 49 days ago | 0 comments
RNA-targeting CRISPR reveals that noncoding RNAs are not 'junk' (phys.org)
Genes contain instructions for making proteins, and a central dogma of biology is that this information flows from DNA to RNA to proteins. But only two percent of the human genome actually encodes proteins; the function of the remaining 98% remains largely unknown.
RNA, Genetics, Science, Biology, Non-Coding RNA
164 points by PaulHoule 50 days ago | 95 comments
Direct testing of natural twister ribozymes from over a thousand organisms (academic.oup.com)
To address this gap, we developed Cleavage High-Throughput Assay (CHiTA), a high-throughput pipeline utilizing massively parallel oligonucleotide synthesis and next-generation sequencing to test putative ribozymes en masse in a scarless fashion.
Biology, Genetics, Research, Scientific Discovery, High-Throughput Screening
16 points by PaulHoule 52 days ago | 3 comments
Premature Graying of Hair: Review with Updates (nlm.nih.gov)
Premature graying of hair (PGH) is defined as graying of hair before the age of 20 years in Caucasians and before 30 years in African American population.
Health, Hair Care, Genetics, Aging
119 points by luu 53 days ago | 110 comments
Fat Cells Remember Obesity, Driving the Yo-Yo Effect (technologynetworks.com)
Researchers uncover how epigenetic memory in fat cells drives the yo-yo effect, making weight regain more likely.
Obesity, Health, Genetics, Epigenetics, Weight Loss
5 points by gmays 53 days ago | 1 comments
How human brains got so big: cells learned to handle stress that comes with size (nature.com)
Humans have evolved disproportionately large brains compared with our primate relatives — but this neurological upgrade came at a cost. Scientists exploring the trade-off have discovered unique genetic features that show how human brain cells handle the stress of keeping a big brain working. The work could inspire new lines of research to understand conditions such as Parkinson’s disease and schizophrenia.
Evolution, Neuroscience, Genetics, Brain Health
7 points by bookofjoe 59 days ago | 0 comments
Vegetarianism is causally correlated with negative mental well-being (frontiersin.org)
This study is the first to employ bidirectional two-sample MR analyses to investigate the causal relationships between genetically predicted vegetarianism and depressive symptoms, neuroticism, and SWB.
Vegetarianism, Mental Health, Science, Psychology, Genetics
7 points by noch 59 days ago | 4 comments