Hacker News with Generative AI: Autism

The sudden rise of AuDHD: autism and ADHD (2024) (theguardian.com)
Just over a decade ago, autism and ADHD were thought to be mutually exclusive. But in recent years, all that has changed

Autism, ADHD, Mental Health, Psychology, Neurodiversity

14 points by rossant 26 days ago | 5 comments

CDC to study vaccines and autism despite research showing no connection (theguardian.com)
The Centers for Disease Control and Prevention (CDC) is planning a large study into potential connections between vaccines and autism, two sources familiar with the matter told Reuters, despite extensive scientific research that has disproved or failed to find evidence of such links.

Vaccines, Autism, Health, Science, Public Health

50 points by rntn 26 days ago | 69 comments

Linux Equals Autism (instagram.com)

Linux, Autism, Social Media, Internet Culture

6 points by initramfs 30 days ago | 0 comments

Increased Toxicity Risk Identified for Children with Autism, ADHD (sciencealert.com)
A study published in 2023 revealed there's a difference in how children with autism or ADHD clear the common plastic additive bisphenol A (BPA), compared to neurotypical children.

Autism, ADHD, Health, Science, Children

5 points by amichail 67 days ago | 0 comments

Research Finds Vaccines Are Not Behind the Rise in Autism. So What Is? (nytimes.com)
There is no one factor that causes autism — or explains its growing prevalence. Researchers are seeking explanations for the surge. Here are some possibilities.

Science, Autism, Health, Research

17 points by thelastgallon 82 days ago | 13 comments

UnitedHealth Is Strategically Limiting Access to Treatment for Kids with Autism (propublica.org)
There was a time when Sharelle Menard thought her son would never be able to speak. She couldn’t soothe Benji when he cried, couldn’t read him books he could follow, couldn’t take him out in public. “The screaming, and screaming, and screaming,” she said. “He would get so frustrated because he couldn’t communicate.”

Health, Autism, Healthcare Policy, Insurance

48 points by stefankuehnel 108 days ago | 23 comments

UnitedHealth Strategically Limits Access to Treatment for Kids with Autism (propublica.org)
There was a time when Sharelle Menard thought her son would never be able to speak. She couldn’t soothe Benji when he cried, couldn’t read him books he could follow, couldn’t take him out in public. “The screaming, and screaming, and screaming,” she said. “He would get so frustrated because he couldn’t communicate.”

Health, Autism, Healthcare, Insurance, Children

11 points by hn_acker 110 days ago | 2 comments

The 24 DNA letters linked to autism: GCAAGGACATATGGGCGAAGGAGA (elpais.com)
Around one in 100 people live with an autism spectrum disorder, a developmental brain disorder characterized by difficulties in social interaction and unusual behavior patterns, such as an acute attention to detail.

Genetics, Autism, Neuroscience, Health

4 points by marban 118 days ago | 0 comments

An Economic and Rational Choice Approach to the Autism Spectrum, Neurodiversity (2011) (ssrn.com)
This paper considers an economic approach to autistic individuals, as a window for understanding autism, as a new and growing branch of neuroeconomics (how does behavior vary with neurology?), and as a foil for better understanding non-autistics and their cognitive biases.

Economics, Autism, Neurodiversity, Cognitive Bias

5 points by FergusArgyll 126 days ago | 0 comments

The Anti-Autism Manifesto (woodfromeden.substack.com)
I have always been skeptical of the high-functioning autism label. “Autism” was originally a very severe disability. Then all other psychiatric diagnoses for children with social difficulties were removed, so quite suddenly, also otherwise normal people with some social quirks are said to be autistic.

Autism, Psychology, Social Science

13 points by paulpauper 130 days ago | 7 comments

Salon retracts 2005 Robert F. Kennedy Jr. piece on alleged autism-vaccine link (2011) (retractionwatch.com)
Salon today retracted a controversial 2005 story by Robert F. Kennedy, Jr. about an alleged link between autism and thimerosal, the mercury-based preservative formerly used in vaccines.

Science, Health, Media, Vaccines, Autism

26 points by leephillips 137 days ago | 1 comments

Autism's Four Core Subtypes (thetransmitter.org)
Despite the huge variation in how autistic people experience the condition, they can be divided into just four subgroups, according to a preprint. The people in these groups—who share similar traits and life outcomes—carry gene variants that implicate distinct biological pathways, the researchers found.

Autism, Science, Genetics, Biology, Preprint

141 points by domofutu 165 days ago | 120 comments

Tell HN: Texas about to execute Robert Roberson, a 57-year-old man with autism (ycombinator.com)
On Thursday, Texas is likely to execute Robert Roberson, 57, a man with autism sentenced to death in 2003 after his daughter Nikki died [1, 2].

Texas, Capital Punishment, Autism, Criminal Justice

29 points by rossant 170 days ago | 4 comments

Opinion letter about Robert Roberson, about to be executed in Texas (shakenbaby.science)
How far can we go in the name of "science"? As Robert Roberson, a 57-year-old autistic American, faces execution in Texas on October 17, this question takes on a particularly urgent resonance.

Capital Punishment, Autism, Science, Texas

13 points by rossant 181 days ago | 1 comments

Seven things I wish I would not hear as an autist (superdurszlak.dev)
Among all the health conditions, diseases, disabilities and neuro-developmental challenges, it seems that Autism Spectrum Disorder is notorious for giving everybody a solid headache, no matter how they came to interact with it - as researchers, diagnosticians, autists ourselves or people who just are there around us as our family members, partners, friends or acquaintances.

Autism, Personal Experience, Disability

16 points by todsacerdoti 184 days ago | 16 comments

Ro'im Rachok is an IDF unit for autistic adults (wikipedia.org)
Ro'im Rachok (Hebrew: רואים רחוק, lit. 'looking ahead') is a program designed to train young autistic adults in professions by the Israel Defense Forces.

Military, Autism, Israel, Employment

12 points by apsec112 185 days ago | 4 comments

Knocking out one key gene leads to autistic traits (rockefeller.edu)
More than 70 genes have been linked to autism spectrum disorder (ASD), a developmental condition in which differences in the brain lead to a host of altered behaviors, including issues with language, social communication, hyperactivity, and repetitive movements.

Genetics, Autism, Neuroscience, Research

43 points by marc__1 197 days ago | 89 comments

Ask HN: Former gifted children with hard lives, how did you turn out? (ycombinator.com)
For various life reasons, I developed depression, and I am autistic and have ADHD (diagnosed, treated). I didn’t get treatment for my ADHD till after college.

Life Experiences, Mental Health, Autism, ADHD, Gifted Children

375 points by askHN2024 199 days ago | 326 comments

Study: Playing D&D helps autistic players in social interactions (arstechnica.com)

Autism, Social Skills, Role-Playing Games, Games, Science

184 points by tomgp 208 days ago | 89 comments

Steve Silberman, writer on the Grateful Dead and autism, dies at 66 (sfstandard.com)

Obituary, Music, Autism

13 points by bookofjoe 210 days ago | 1 comments

Male autism is linked to brain aromatase disruption by maternal bisphenol A (nature.com)

Autism, Science, Biology, Health, Neuroscience

52 points by davikr 227 days ago | 14 comments

AFP Spent $500k Trying to Lock Up Autistic 13-Year-Old on Terrorism Charges (techdirt.com)