Hacker News with Generative AI: Autism

Increased Toxicity Risk Identified for Children with Autism, ADHD (sciencealert.com)
A study published in 2023 revealed there's a difference in how children with autism or ADHD clear the common plastic additive bisphenol A (BPA), compared to neurotypical children.
Research Finds Vaccines Are Not Behind the Rise in Autism. So What Is? (nytimes.com)
There is no one factor that causes autism — or explains its growing prevalence. Researchers are seeking explanations for the surge. Here are some possibilities.
UnitedHealth Is Strategically Limiting Access to Treatment for Kids with Autism (propublica.org)
There was a time when Sharelle Menard thought her son would never be able to speak. She couldn’t soothe Benji when he cried, couldn’t read him books he could follow, couldn’t take him out in public. “The screaming, and screaming, and screaming,” she said. “He would get so frustrated because he couldn’t communicate.”
UnitedHealth Strategically Limits Access to Treatment for Kids with Autism (propublica.org)
There was a time when Sharelle Menard thought her son would never be able to speak. She couldn’t soothe Benji when he cried, couldn’t read him books he could follow, couldn’t take him out in public. “The screaming, and screaming, and screaming,” she said. “He would get so frustrated because he couldn’t communicate.”
The 24 DNA letters linked to autism: GCAAGGACATATGGGCGAAGGAGA (elpais.com)
Around one in 100 people live with an autism spectrum disorder, a developmental brain disorder characterized by difficulties in social interaction and unusual behavior patterns, such as an acute attention to detail.
An Economic and Rational Choice Approach to the Autism Spectrum, Neurodiversity (2011) (ssrn.com)
This paper considers an economic approach to autistic individuals, as a window for understanding autism, as a new and growing branch of neuroeconomics (how does behavior vary with neurology?), and as a foil for better understanding non-autistics and their cognitive biases.
The Anti-Autism Manifesto (woodfromeden.substack.com)
I have always been skeptical of the high-functioning autism label. “Autism” was originally a very severe disability. Then all other psychiatric diagnoses for children with social difficulties were removed, so quite suddenly, also otherwise normal people with some social quirks are said to be autistic.
Salon retracts 2005 Robert F. Kennedy Jr. piece on alleged autism-vaccine link (2011) (retractionwatch.com)
Salon today retracted a controversial 2005 story by Robert F. Kennedy, Jr. about an alleged link between autism and thimerosal, the mercury-based preservative formerly used in vaccines.
Autism's Four Core Subtypes (thetransmitter.org)
Despite the huge variation in how autistic people experience the condition, they can be divided into just four subgroups, according to a preprint. The people in these groups—who share similar traits and life outcomes—carry gene variants that implicate distinct biological pathways, the researchers found.
Tell HN: Texas about to execute Robert Roberson, a 57-year-old man with autism (ycombinator.com)
On Thursday, Texas is likely to execute Robert Roberson, 57, a man with autism sentenced to death in 2003 after his daughter Nikki died [1, 2].
Opinion letter about Robert Roberson, about to be executed in Texas (shakenbaby.science)
How far can we go in the name of "science"? As Robert Roberson, a 57-year-old autistic American, faces execution in Texas on October 17, this question takes on a particularly urgent resonance.
Seven things I wish I would not hear as an autist (superdurszlak.dev)
Among all the health conditions, diseases, disabilities and neuro-developmental challenges, it seems that Autism Spectrum Disorder is notorious for giving everybody a solid headache, no matter how they came to interact with it - as researchers, diagnosticians, autists ourselves or people who just are there around us as our family members, partners, friends or acquaintances.
Ro'im Rachok is an IDF unit for autistic adults (wikipedia.org)
Ro'im Rachok (Hebrew: רואים רחוק, lit. 'looking ahead') is a program designed to train young autistic adults in professions by the Israel Defense Forces.
Knocking out one key gene leads to autistic traits (rockefeller.edu)
More than 70 genes have been linked to autism spectrum disorder (ASD), a developmental condition in which differences in the brain lead to a host of altered behaviors, including issues with language, social communication, hyperactivity, and repetitive movements.
Ask HN: Former gifted children with hard lives, how did you turn out? (ycombinator.com)
For various life reasons, I developed depression, and I am autistic and have ADHD (diagnosed, treated). I didn’t get treatment for my ADHD till after college.
Study: Playing D&D helps autistic players in social interactions (arstechnica.com)
Steve Silberman, writer on the Grateful Dead and autism, dies at 66 (sfstandard.com)
Male autism is linked to brain aromatase disruption by maternal bisphenol A (nature.com)
AFP Spent $500k Trying to Lock Up Autistic 13-Year-Old on Terrorism Charges (techdirt.com)
The Complex Relationship Between ADHD, Autism, and Personality Disorders (traudhd.com)
Male autism spectrum disorder is linked to prenatal BPA (nature.com)
Research finds link between prenatal exposure to plastics and autism in boys (florey.edu.au)
Defining Autistic Burnout (2020) (liebertpub.com)
Reversal of autism symptoms among dizygotic twins: A case report (telegraph.co.uk)
No, Autism Can Not Be Diagnosed by Analyzing the Gut Microbiome (forbes.com)
Children with Autism Carry Unique Gut Flora, Study Finds (nytimes.com)
Brain overgrowth dictates autism severity, new research suggests (medicalxpress.com)
Autism and PTSD Are Vulnerably Linked (neurosciencenews.com)
Metabolism of autism reveals developmental origins (medicalxpress.com)
Autism makes travel a challenge. Here’s how I learned to cope (theguardian.com)