Hacker News with Generative AI: Autism

RFK Jr. says autism database will use Medicare and Medicaid info (npr.org)
The National Institutes of Health will use information from federal health insurance programs Medicare and Medicaid to create a "real-world data platform" to determine the cause of autism, the agency announced this week.
Health, Autism, Research, Government, Healthcare Data
15 points by danso 14 days ago | 0 comments
U.S. State Autism Databases (resiliencymentalhealth.com)
I have written before about my decision not to offer autism evaluations in North Dakota because of a state law that requires me to put my clients on a government list, which is unethical.
Autism, Healthcare, Privacy, Government Regulation
17 points by bookofjoe 18 days ago | 3 comments
'Slippery slope to eugenics': advocates reject RFK Jr's national autism database (theguardian.com)
Autism researchers and advocates are pushing back against the creation of an autism database – meant to track the health of autistic people in a major research study – and pointing to the ways such databases could be misused.
Autism, Health Research, Eugenics, Privacy Concerns
12 points by bookofjoe 18 days ago | 1 comments
RFK Jr is wrong – there's a rich history of autistic poets (theconversation.com)
U.S. Secretary of Health and Human Services Robert F. Kennedy Jr. recently declared autism a national “epidemic,” calling it a “preventable disease” that is growing at an “alarming rate.”
Autism, Health, Politics, Poetry
33 points by teaman2000 23 days ago | 27 comments
Why Autistic Women Have Been Overlooked for Decades (undark.org)
It’s been more than 30 years since the award-winning film “Rain Man,” starring Dustin Hoffman and Tom Cruise, put a spotlight on autism — or, more specifically, on a specific type of autism characterized by social awkwardness and isolation and typically affecting males.
Autism, Women's Health, Representation, Science, Disability
13 points by EA-3167 28 days ago | 1 comments
RFK Jr. Set to Launch Disease Registry Tracking Autistic People (newrepublic.com)
Robert F. Kennedy Jr. is using private medical records to create a registry of people with autism in the United States.
Privacy, Autism, Health
62 points by colinprince 29 days ago | 35 comments
No new autism registry, HHS says, walking back NIH director's claim (statnews.com)
The federal health department is not creating a new registry of Americans with autism, a Department of Health and Human Services official said in a written statement Thursday.
Health, Autism, Government, Science
9 points by zzzeek 29 days ago | 2 comments
RFK Jr.'s autism study to amass medical records of many Americans (cbsnews.com)
The National Institutes of Health is amassing private medical records from a number of federal and commercial databases to give to Health and Human Services Secretary Robert F. Kennedy Jr.'s new effort to study autism, the NIH's top official said Monday.
Health, Science, Autism, Privacy
20 points by cruzcampo 31 days ago | 3 comments
RFK Jr. Knows Amazingly Little About Autism (motherjones.com)
While his anti-vaccine allies swooned and scientists cringed, HHS Secretary Robert F. Kennedy Jr. used his first-ever press conference this week, in response to new data showing an apparent increase in the number of autistic kids, to promote a variety of debunked, half-true, and deeply ableist ideas about autism.
Anti-Vax, Autism, Science, Health
19 points by zzzeek 35 days ago | 3 comments
People with autism struggle to get hired; how businesses can change interviews (theconversation.com)
First impressions matter − they shape how we’re judged in mere seconds, research shows. People are quick to evaluate others’ competence, likability and honesty, often relying on superficial cues such as appearance or handshake strength. While these snap judgments can be flawed, they often have a lasting impact. In employment, first impressions not only affect hiring choices but also decisions about promotion years later.
Autism, Hiring Practices, Employment, First Impressions
4 points by rntn 36 days ago | 0 comments
Gut-brain link may affect behavior in children with autism (medicalxpress.com)
A new USC study suggests that gut imbalances in children with autism may create an imbalance of metabolites in the digestive system—ultimately disrupting neurotransmitter production and influencing behavioral symptoms.
Autism, Health, Neuroscience, Children
9 points by wglb 36 days ago | 1 comments
The Genetic Puzzle of Autism: Why Some Develop It and Others Don't (bbc.com)
Genetic factors are thought to play a major role in the development of autism – but for decades what they are has proven elusive. Now scientists are starting to uncover clues.
Genetics, Autism, Science, Health
7 points by Korling 37 days ago | 0 comments
Autism rate rises slightly; RFK Jr. claims he'll "have answers by September" (arstechnica.com)
The rate of autism in a group of 8-year-olds in the US rose from 2.76 percent (1 in 36) in 2020 to 3.22 percent (1 in 31) in 2022, according to a study out Tuesday in the Morbidity and Mortality Weekly Report, a journal published by the Centers for Disease Control and Prevention.
Autism, Health, Science, Politics
7 points by voxadam 37 days ago | 2 comments
RFK Jr. vows to find cause of autism by September – experts have doubts (cbc.ca)
U.S. Health Secretary Robert F. Kennedy Jr. has pledged that the country's top health agency will pinpoint the cause of autism by September, an announcement which sparked a wave of concern among medical experts and advocates who question the feasibility and focus of the research.
Health, Autism, Politics, Science, Controversy
22 points by barbazoo 42 days ago | 6 comments
The sudden rise of AuDHD: autism and ADHD (2024) (theguardian.com)
Just over a decade ago, autism and ADHD were thought to be mutually exclusive. But in recent years, all that has changed
Autism, ADHD, Mental Health, Psychology, Neurodiversity
14 points by rossant 77 days ago | 5 comments
CDC to study vaccines and autism despite research showing no connection (theguardian.com)
The Centers for Disease Control and Prevention (CDC) is planning a large study into potential connections between vaccines and autism, two sources familiar with the matter told Reuters, despite extensive scientific research that has disproved or failed to find evidence of such links.
Vaccines, Autism, Health, Science, Public Health
50 points by rntn 77 days ago | 69 comments
Linux Equals Autism (instagram.com)
Linux, Autism, Social Media, Internet Culture
6 points by initramfs 82 days ago | 0 comments
Increased Toxicity Risk Identified for Children with Autism, ADHD (sciencealert.com)
A study published in 2023 revealed there's a difference in how children with autism or ADHD clear the common plastic additive bisphenol A (BPA), compared to neurotypical children.
Autism, ADHD, Health, Science, Children
5 points by amichail 118 days ago | 0 comments
Research Finds Vaccines Are Not Behind the Rise in Autism. So What Is? (nytimes.com)
There is no one factor that causes autism — or explains its growing prevalence. Researchers are seeking explanations for the surge. Here are some possibilities.
Science, Autism, Health, Research
17 points by thelastgallon 134 days ago | 13 comments
UnitedHealth Is Strategically Limiting Access to Treatment for Kids with Autism (propublica.org)
There was a time when Sharelle Menard thought her son would never be able to speak. She couldn’t soothe Benji when he cried, couldn’t read him books he could follow, couldn’t take him out in public. “The screaming, and screaming, and screaming,” she said. “He would get so frustrated because he couldn’t communicate.”
Health, Autism, Healthcare Policy, Insurance
48 points by stefankuehnel 160 days ago | 23 comments
UnitedHealth Strategically Limits Access to Treatment for Kids with Autism (propublica.org)
There was a time when Sharelle Menard thought her son would never be able to speak. She couldn’t soothe Benji when he cried, couldn’t read him books he could follow, couldn’t take him out in public. “The screaming, and screaming, and screaming,” she said. “He would get so frustrated because he couldn’t communicate.”
Health, Autism, Healthcare, Insurance, Children
11 points by hn_acker 161 days ago | 2 comments
The 24 DNA letters linked to autism: GCAAGGACATATGGGCGAAGGAGA (elpais.com)
Around one in 100 people live with an autism spectrum disorder, a developmental brain disorder characterized by difficulties in social interaction and unusual behavior patterns, such as an acute attention to detail.
Genetics, Autism, Neuroscience, Health
4 points by marban 170 days ago | 0 comments
An Economic and Rational Choice Approach to the Autism Spectrum, Neurodiversity (2011) (ssrn.com)
This paper considers an economic approach to autistic individuals, as a window for understanding autism, as a new and growing branch of neuroeconomics (how does behavior vary with neurology?), and as a foil for better understanding non-autistics and their cognitive biases.
Economics, Autism, Neurodiversity, Cognitive Bias
5 points by FergusArgyll 177 days ago | 0 comments
The Anti-Autism Manifesto (woodfromeden.substack.com)
I have always been skeptical of the high-functioning autism label. “Autism” was originally a very severe disability. Then all other psychiatric diagnoses for children with social difficulties were removed, so quite suddenly, also otherwise normal people with some social quirks are said to be autistic.
Autism, Psychology, Social Science
13 points by paulpauper 181 days ago | 7 comments
Salon retracts 2005 Robert F. Kennedy Jr. piece on alleged autism-vaccine link (2011) (retractionwatch.com)
Salon today retracted a controversial 2005 story by Robert F. Kennedy, Jr. about an alleged link between autism and thimerosal, the mercury-based preservative formerly used in vaccines.
Science, Health, Media, Vaccines, Autism
26 points by leephillips 188 days ago | 1 comments
Autism's Four Core Subtypes (thetransmitter.org)
Despite the huge variation in how autistic people experience the condition, they can be divided into just four subgroups, according to a preprint. The people in these groups—who share similar traits and life outcomes—carry gene variants that implicate distinct biological pathways, the researchers found.
Autism, Science, Genetics, Biology, Preprint
141 points by domofutu 216 days ago | 120 comments
Tell HN: Texas about to execute Robert Roberson, a 57-year-old man with autism (ycombinator.com)
On Thursday, Texas is likely to execute Robert Roberson, 57, a man with autism sentenced to death in 2003 after his daughter Nikki died [1, 2].
Texas, Capital Punishment, Autism, Criminal Justice
29 points by rossant 221 days ago | 4 comments
Opinion letter about Robert Roberson, about to be executed in Texas (shakenbaby.science)
How far can we go in the name of "science"? As Robert Roberson, a 57-year-old autistic American, faces execution in Texas on October 17, this question takes on a particularly urgent resonance.
Capital Punishment, Autism, Science, Texas
13 points by rossant 232 days ago | 1 comments
Seven things I wish I would not hear as an autist (superdurszlak.dev)
Among all the health conditions, diseases, disabilities and neuro-developmental challenges, it seems that Autism Spectrum Disorder is notorious for giving everybody a solid headache, no matter how they came to interact with it - as researchers, diagnosticians, autists ourselves or people who just are there around us as our family members, partners, friends or acquaintances.
Autism, Personal Experience, Disability
16 points by todsacerdoti 235 days ago | 16 comments
Ro'im Rachok is an IDF unit for autistic adults (wikipedia.org)
Ro'im Rachok (Hebrew: רואים רחוק, lit. 'looking ahead') is a program designed to train young autistic adults in professions by the Israel Defense Forces.
Military, Autism, Israel, Employment
12 points by apsec112 236 days ago | 4 comments