Hacker News with Generative AI: Autism

Why Autistic Women Have Been Overlooked for Decades (undark.org)
It’s been more than 30 years since the award-winning film “Rain Man,” starring Dustin Hoffman and Tom Cruise, put a spotlight on autism — or, more specifically, on a specific type of autism characterized by social awkwardness and isolation and typically affecting males.

Autism, Women's Health, Representation, Science, Disability

7 points by EA-3167 7 hours ago | 0 comments

RFK Jr. Set to Launch Disease Registry Tracking Autistic People (newrepublic.com)
Robert F. Kennedy Jr. is using private medical records to create a registry of people with autism in the United States.

Privacy, Autism, Health

59 points by colinprince 1 day ago | 35 comments

No new autism registry, HHS says, walking back NIH director's claim (statnews.com)
The federal health department is not creating a new registry of Americans with autism, a Department of Health and Human Services official said in a written statement Thursday.

Health, Autism, Government, Science

8 points by zzzeek 1 day ago | 2 comments

RFK Jr.'s autism study to amass medical records of many Americans (cbsnews.com)
The National Institutes of Health is amassing private medical records from a number of federal and commercial databases to give to Health and Human Services Secretary Robert F. Kennedy Jr.'s new effort to study autism, the NIH's top official said Monday.

Health, Science, Autism, Privacy

20 points by cruzcampo 4 days ago | 3 comments

RFK Jr. Knows Amazingly Little About Autism (motherjones.com)
While his anti-vaccine allies swooned and scientists cringed, HHS Secretary Robert F. Kennedy Jr. used his first-ever press conference this week, in response to new data showing an apparent increase in the number of autistic kids, to promote a variety of debunked, half-true, and deeply ableist ideas about autism.

Anti-Vax, Autism, Science, Health

19 points by zzzeek 7 days ago | 3 comments

People with autism struggle to get hired; how businesses can change interviews (theconversation.com)
First impressions matter − they shape how we’re judged in mere seconds, research shows. People are quick to evaluate others’ competence, likability and honesty, often relying on superficial cues such as appearance or handshake strength. While these snap judgments can be flawed, they often have a lasting impact. In employment, first impressions not only affect hiring choices but also decisions about promotion years later.

Autism, Hiring Practices, Employment, First Impressions

4 points by rntn 8 days ago | 0 comments

Gut-brain link may affect behavior in children with autism (medicalxpress.com)
A new USC study suggests that gut imbalances in children with autism may create an imbalance of metabolites in the digestive system—ultimately disrupting neurotransmitter production and influencing behavioral symptoms.

Autism, Health, Neuroscience, Children

9 points by wglb 9 days ago | 1 comments

The Genetic Puzzle of Autism: Why Some Develop It and Others Don't (bbc.com)
Genetic factors are thought to play a major role in the development of autism – but for decades what they are has proven elusive. Now scientists are starting to uncover clues.

Genetics, Autism, Science, Health

7 points by Korling 9 days ago | 0 comments

Autism rate rises slightly; RFK Jr. claims he'll "have answers by September" (arstechnica.com)
The rate of autism in a group of 8-year-olds in the US rose from 2.76 percent (1 in 36) in 2020 to 3.22 percent (1 in 31) in 2022, according to a study out Tuesday in the Morbidity and Mortality Weekly Report, a journal published by the Centers for Disease Control and Prevention.

Autism, Health, Science, Politics

7 points by voxadam 10 days ago | 2 comments

RFK Jr. vows to find cause of autism by September – experts have doubts (cbc.ca)
U.S. Health Secretary Robert F. Kennedy Jr. has pledged that the country's top health agency will pinpoint the cause of autism by September, an announcement which sparked a wave of concern among medical experts and advocates who question the feasibility and focus of the research.

Health, Autism, Politics, Science, Controversy

22 points by barbazoo 14 days ago | 6 comments

The sudden rise of AuDHD: autism and ADHD (2024) (theguardian.com)
Just over a decade ago, autism and ADHD were thought to be mutually exclusive. But in recent years, all that has changed

Autism, ADHD, Mental Health, Psychology, Neurodiversity

14 points by rossant 49 days ago | 5 comments

CDC to study vaccines and autism despite research showing no connection (theguardian.com)
The Centers for Disease Control and Prevention (CDC) is planning a large study into potential connections between vaccines and autism, two sources familiar with the matter told Reuters, despite extensive scientific research that has disproved or failed to find evidence of such links.

Vaccines, Autism, Health, Science, Public Health

50 points by rntn 49 days ago | 69 comments

Linux Equals Autism (instagram.com)

Linux, Autism, Social Media, Internet Culture

6 points by initramfs 54 days ago | 0 comments

Increased Toxicity Risk Identified for Children with Autism, ADHD (sciencealert.com)
A study published in 2023 revealed there's a difference in how children with autism or ADHD clear the common plastic additive bisphenol A (BPA), compared to neurotypical children.

Autism, ADHD, Health, Science, Children

5 points by amichail 90 days ago | 0 comments

Research Finds Vaccines Are Not Behind the Rise in Autism. So What Is? (nytimes.com)
There is no one factor that causes autism — or explains its growing prevalence. Researchers are seeking explanations for the surge. Here are some possibilities.

Science, Autism, Health, Research

17 points by thelastgallon 106 days ago | 13 comments

UnitedHealth Is Strategically Limiting Access to Treatment for Kids with Autism (propublica.org)
There was a time when Sharelle Menard thought her son would never be able to speak. She couldn’t soothe Benji when he cried, couldn’t read him books he could follow, couldn’t take him out in public. “The screaming, and screaming, and screaming,” she said. “He would get so frustrated because he couldn’t communicate.”

Health, Autism, Healthcare Policy, Insurance

48 points by stefankuehnel 132 days ago | 23 comments

UnitedHealth Strategically Limits Access to Treatment for Kids with Autism (propublica.org)
There was a time when Sharelle Menard thought her son would never be able to speak. She couldn’t soothe Benji when he cried, couldn’t read him books he could follow, couldn’t take him out in public. “The screaming, and screaming, and screaming,” she said. “He would get so frustrated because he couldn’t communicate.”

Health, Autism, Healthcare, Insurance, Children

11 points by hn_acker 134 days ago | 2 comments

The 24 DNA letters linked to autism: GCAAGGACATATGGGCGAAGGAGA (elpais.com)
Around one in 100 people live with an autism spectrum disorder, a developmental brain disorder characterized by difficulties in social interaction and unusual behavior patterns, such as an acute attention to detail.

Genetics, Autism, Neuroscience, Health

4 points by marban 142 days ago | 0 comments

An Economic and Rational Choice Approach to the Autism Spectrum, Neurodiversity (2011) (ssrn.com)
This paper considers an economic approach to autistic individuals, as a window for understanding autism, as a new and growing branch of neuroeconomics (how does behavior vary with neurology?), and as a foil for better understanding non-autistics and their cognitive biases.

Economics, Autism, Neurodiversity, Cognitive Bias

5 points by FergusArgyll 150 days ago | 0 comments

The Anti-Autism Manifesto (woodfromeden.substack.com)
I have always been skeptical of the high-functioning autism label. “Autism” was originally a very severe disability. Then all other psychiatric diagnoses for children with social difficulties were removed, so quite suddenly, also otherwise normal people with some social quirks are said to be autistic.

Autism, Psychology, Social Science

13 points by paulpauper 154 days ago | 7 comments

Salon retracts 2005 Robert F. Kennedy Jr. piece on alleged autism-vaccine link (2011) (retractionwatch.com)
Salon today retracted a controversial 2005 story by Robert F. Kennedy, Jr. about an alleged link between autism and thimerosal, the mercury-based preservative formerly used in vaccines.

Science, Health, Media, Vaccines, Autism

26 points by leephillips 160 days ago | 1 comments

Autism's Four Core Subtypes (thetransmitter.org)
Despite the huge variation in how autistic people experience the condition, they can be divided into just four subgroups, according to a preprint. The people in these groups—who share similar traits and life outcomes—carry gene variants that implicate distinct biological pathways, the researchers found.

Autism, Science, Genetics, Biology, Preprint

141 points by domofutu 188 days ago | 120 comments

Tell HN: Texas about to execute Robert Roberson, a 57-year-old man with autism (ycombinator.com)
On Thursday, Texas is likely to execute Robert Roberson, 57, a man with autism sentenced to death in 2003 after his daughter Nikki died [1, 2].

Texas, Capital Punishment, Autism, Criminal Justice

29 points by rossant 194 days ago | 4 comments

Opinion letter about Robert Roberson, about to be executed in Texas (shakenbaby.science)
How far can we go in the name of "science"? As Robert Roberson, a 57-year-old autistic American, faces execution in Texas on October 17, this question takes on a particularly urgent resonance.

Capital Punishment, Autism, Science, Texas

13 points by rossant 204 days ago | 1 comments

Seven things I wish I would not hear as an autist (superdurszlak.dev)
Among all the health conditions, diseases, disabilities and neuro-developmental challenges, it seems that Autism Spectrum Disorder is notorious for giving everybody a solid headache, no matter how they came to interact with it - as researchers, diagnosticians, autists ourselves or people who just are there around us as our family members, partners, friends or acquaintances.

Autism, Personal Experience, Disability

16 points by todsacerdoti 207 days ago | 16 comments

Ro'im Rachok is an IDF unit for autistic adults (wikipedia.org)
Ro'im Rachok (Hebrew: רואים רחוק, lit. 'looking ahead') is a program designed to train young autistic adults in professions by the Israel Defense Forces.

Military, Autism, Israel, Employment

12 points by apsec112 208 days ago | 4 comments

Knocking out one key gene leads to autistic traits (rockefeller.edu)
More than 70 genes have been linked to autism spectrum disorder (ASD), a developmental condition in which differences in the brain lead to a host of altered behaviors, including issues with language, social communication, hyperactivity, and repetitive movements.

Genetics, Autism, Neuroscience, Research

43 points by marc__1 220 days ago | 89 comments

Ask HN: Former gifted children with hard lives, how did you turn out? (ycombinator.com)
For various life reasons, I developed depression, and I am autistic and have ADHD (diagnosed, treated). I didn’t get treatment for my ADHD till after college.

Life Experiences, Mental Health, Autism, ADHD, Gifted Children

375 points by askHN2024 223 days ago | 326 comments

Study: Playing D&D helps autistic players in social interactions (arstechnica.com)

Autism, Social Skills, Role-Playing Games, Games, Science

184 points by tomgp 232 days ago | 89 comments

Steve Silberman, writer on the Grateful Dead and autism, dies at 66 (sfstandard.com)

Obituary, Music, Autism

13 points by bookofjoe 234 days ago | 1 comments